nirC

Information for nirC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3494188-3494514 + CDS nirD EG10655 nitrite reductase (NAD(P)H) subunit 3494892-3495446 + CDS nirC EG10654 nitrite reductase activity 3495465-3496838 + CDS cysG EG10188 uroporphyrinogen III methylase; sirohaeme biosynthesis

Reported regulatory sites for nirC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.972 3494525-3494541 taacg GGAGGCGCAATGCCTCC ccttt - 0 - 4.445 3494641-3494661 tcaaa TGTTTACAGACACTATTAATA agtgt - 0 - 3.881 3494808-3494826 ccgta CGCCCTTTGGTGATGGGCG cgacc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back