nlp

Information for nlp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3331351-3332322 + CDS ispB EG10017 octaprenyl diphosphate synthase 3332550-3332828 + CDS nlp EG10656 regulatory factor of maltose metabolism; similar to Ner repressor protein of phage Mu 3332876-3334135 - CDS murA EG11358 first step in murein biosynthesis;UDP-N-glucosamine 1-carboxyvinyltransferase

Reported regulatory sites for nlp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.496 3332336-3332354 cctca TCCCGCGCAGCGCGCGGGA tggtt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.919 3332424-3332444 catct TTATATATTCTGAATATTCAC actct - 0 - 1.884 3332449-3332466 cactc TTTACAGGAACTTTTTAG agcaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back