nlpC

Information for nlpC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1789331-1790044 - CDS b1707 EG13981 orf; hypothetical protein 1790291-1790755 - CDS nlpC EG11133 lipoprotein 1790833-1791582 - CDS btuD EG10128 ATP-binding component of vitamin B12 transport system

Reported regulatory sites for nlpC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.209 1790774-1790797 R acgac GCTAAATTAATGCAAGAATAAAAA acaga - 0 - 1.484 1790798-1790820 R agtat CTTGAAAATCGGGTAATTACGAC gctaa - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back