nrdD

Information for nrdD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4457474-4457938 - CDS nrdG EG12523 anaerobic ribonucleotide reductase activating protein 4458096-4460234 - CDS nrdD EG11417 anaerobic ribonucleoside-triphosphate reductase 4460628-4462283 - CDS treC EG11402 trehalase 6-P hydrolase

Reported regulatory sites for nrdD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.932 4460425-4460444 R atgca AAGCACTATATATAGACTTT aaaat - 0 - 4.932 4460394-4460413 R cgtcc CAACCCAATATGTTGTATTA atcga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.085 4460468-4460485 R tttta CTTTGAGCTACATCAAAA aaagc - 0 - 1.423 4460446-4460465 R aaaaa AGCTCAAACATCCTTGATGC aaagc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back