nrdG

Information for nrdG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4457127-4457429 + CDS cybC EG50008 cytochrome b(562) 4457474-4457938 - CDS nrdG EG12523 anaerobic ribonucleotide reductase activating protein 4458096-4460234 - CDS nrdD EG11417 anaerobic ribonucleoside-triphosphate reductase

Reported regulatory sites for nrdG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.181 4458041-4458056 R cgtaa ACGCCTTATCCGGCCT acatt - 0 REP338b (16) 4.181 4458007-4458022 R gctcc AGGTCTGATAAGACGC gacag - 0 REP338a (16) 1.869 4458052-4458072 R caaat GCCGGATGCGGCGTAAACGCC ttatc - 0 REP338b (21) 1.869 4457989-4458009 R taaga CGCGACAGCGTCGCATCAGGC attga - 0 REP338a (21)

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back