nrdH
 
Information for nrdH, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2798155-2798496
+
CDS
orf; hypothetical protein
2798744-2798989
+
CDS
nrdH
glutaredoxin-like protein; hydrogen donor
2798986-2799396
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for nrdH:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
6.980
2798639-2798660
ttgtg TGGTTGAATCTTTTTTCAACTA catct
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.242
2798694-2798715
acaac CCGACGCGTATCATCGCGCCGT atctt
-
0
-
3.328
2798717-2798735
ccgta TCTTCATTTTAAACGGAAA tacga
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back