nrdH

Information for nrdH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2798155-2798496 + CDS ygaM EG13285 orf; hypothetical protein 2798744-2798989 + CDS nrdH EG13286 glutaredoxin-like protein; hydrogen donor 2798986-2799396 + CDS nrdI EG13287 orf; hypothetical protein

Reported regulatory sites for nrdH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.980 2798639-2798660 ttgtg TGGTTGAATCTTTTTTCAACTA catct - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.242 2798694-2798715 acaac CCGACGCGTATCATCGCGCCGT atctt - 0 - 3.328 2798717-2798735 ccgta TCTTCATTTTAAACGGAAA tacga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back