nrfA

Information for nrfA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4282992-4284950 - CDS acs EG11448 acetyl-CoA synthetase 4285343-4286779 + CDS nrfA EG11781 periplasmic cytochrome c(552): plays a role in nitrite reduction 4286818-4287390 + CDS nrfB EG11945 formate-dependent nitrite reductase; a penta-haeme cytochrome c

Reported regulatory sites for nrfA: Genome coordinates Source Transcription factor Transcription factor annotation 4285198-4285219 DPInteract fnr transcriptional regulation of aerobic anaerobic respiration osmotic balance 4285168-4285183 DPInteract narL pleiotrophic regulation of anaerobic respiration: response regulator for nar frd dms and tor genes 4285168-4285183 DPInteract narP nitrate/nitrite response regulator (sensor NarQ)

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.862 4285230-4285246 tgtgg TTATTTGTTACACATAG gggcg - 0 - 5.061 4285030-4285051 tagta TTTGGGCGACAGATCACGCAAA agtag - 0 - 4.314 4285172-4285190 ctaac TCTAAAGTGGTATTTTACA tgcac narP narL 12 12 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back