nuoC

Information for nuoC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2399572-2400072 - CDS nuoE EG12086 NADH dehydrogenase I chain E 2400075-2401877 - CDS nuoC EG12084 NADH dehydrogenase I chain C; D 2401971-2402633 - CDS nuoB EG12083 NADH dehydrogenase I chain B

Reported regulatory sites for nuoC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.181 2401954-2401970 R tttaa TTTGCGCCTGTCGGCAA aggga - 0 - 1.298 2401879-2401895 R acagt CACCACGGACCATTTGC aatgg - 0 - 1.137 2401931-2401951 R caaag GGATTTTTCTTCGCTTATTCC taaat - 0 - 1.137 2401905-2401925 R taaat CTATTTCGCGAAGCTTACTGC gccga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back