nuoN

Information for nuoN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2387133-2387984 + CDS b2275 EG14100 orf; hypothetical protein 2388068-2389345 - CDS nuoN EG12093 NADH dehydrogenase I chain N 2389532-2391061 - CDS nuoM EG11773 NADH dehydrogenase I chain M

Reported regulatory sites for nuoN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.903 2389460-2389481 R ttgct GATCGTCGGCTTGACGGTGGTG gttgt - 0 - 4.867 2389517-2389532 R ccgta AATCGCCATGACAATA actcc - 0 - 4.689 2389484-2389506 R acaaa ACCTGATCGCACTGCTACCGTTG ctgat - 0 - 4.689 2389422-2389444 R tctcc ATTGCGTGGCGACGCAATCATTT cctca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back