nupG

Information for nupG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3102448-3103530 + CDS mltC EG12986 membrane-bound lytic murein transglycosylase C 3103684-3104988 + CDS nupG EG10664 transport of nucleosides; permease protein 3105038-3107233 - CDS speC EG10961 ornithine decarboxylase isozyme

Reported regulatory sites for nupG: Genome coordinates Source Transcription factor Transcription factor annotation 3103566-3103587 DPInteract crp cyclic AMP receptor protein 3103616-3103637 DPInteract crp cyclic AMP receptor protein 3103584-3103623 PMID: 8596434 & RegulonDB cytR regulator for deo operon udp cdd tsx nupC and nupG

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.354 3103617-3103638 gcaat TATTTGCCACAGGTAACAAAAA accag cytR crp 7 21 - 4.515 3103542-3103563 taacc GCCCCTGACGATGCTCAGGGGC aaaaa - 0 - - 3.735 3103565-3103588 gggca AAAATGTTATCCACATCACAATTT cgttt cytR crp 5 22 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back