ompC

Information for ompC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2308499-2309554 - CDS yojL EG12073 orf; hypothetical protein 2309666-2310769 - CDS ompC EG10670 outer membrane protein 1b (Ib;c) 2311508-2314180 + CDS yojN EG12385 putative 2-component sensor protein

Reported regulatory sites for ompC: Genome coordinates Source Transcription factor Transcription factor annotation 2310929-2310948 DPInteract ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis 2310907-2310924 PMID: 8002608 & PMID: 9719640 ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis 2310887-2310904 PMID: 8002608 & PMID: 9719640 ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis 2310780-2310793 PMID: 8002608 lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2310841-2310857 PMID: 8002608 lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2310870-2310889 PMID: 8002608 & RegulonDB lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2311052-2311064 PMID: 8002608 lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2311123-2311138 PMID: 8002608 lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2311154-2311169 PMID: 8002608 lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2311183-2311198 PMID: 8002608 lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 2311008-2311043 PMID: 2203749 & RegulonDB ihf integration host factor (IHF)

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.280 2310821-2310844 R tgccg ACTGATTAATGAGGGTTAATCAGT atgca lrp 4 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.511 2311132-2311151 R aaaca GACATTCAGAAATGAATGAC ggtaa lrp 7 - 5.170 2311168-2311190 R aaaaa AACCGAATGCGAGGCATCCGGTT gaaat lrp 10 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back