ompF

Information for ompF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 983742-984932 - CDS aspC EG10096 aspartate aminotransferase 985117-986205 - CDS ompF EG10671 outer membrane protein 1a (Ia;b;F) 986808-988208 - CDS asnS EG10094 asparagine tRNA synthetase

Reported regulatory sites for ompF: Genome coordinates Source Transcription factor Transcription factor annotation 986449-986516 DPInteract ihf integration host factor (IHF) 986346-986393 DPInteract ihf integration host factor (IHF) 986396-986415 DPInteract ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis 986376-986395 DPInteract ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis 986354-986373 DPInteract ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.901 986413-986430 R gttca CAAAGTTCCTTAAATTTT acttt ompR 3 - 1.901 986270-986287 R tcatc AATAGTTCCGTAAATTTT tattg - 0 - 0.544 986527-986545 R ataaa GTTTCCATCAGAAACAAAA tttcc - 0 - 0.544 986377-986395 R atatt TTTTCTTTTTGAAACCAAA tcttt ompR ihf 19 17 - 0.457 986463-986486 R ataaa TAGATTAAAATTGCTGTAAATATC atcac ihf 24 -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back