ompT

Information for ompT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 582904-583653 + CDS appY EG10050 regulatory protein affecting appA and other genes 583903-584856 - CDS ompT EG10673 outer membrane protein 3b (a); protease VII 585370-586131 - CDS envY EG10268 envelope protein; thermoregulation of porin biosynthesis

Reported regulatory sites for ompT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.681 584942-584965 R taatc ATTCAATACTAAACAAAATATAAA cagtg - 0 - 1.681 584868-584891 R tacat ATTCAATCATTAAAACGATTGAAT ggaga - 0 - 1.022 585297-585313 R gccct GCAGGATTCGAACCTGC ggccc - 0 - 0.997 584995-585017 R aaata TGAAACAATAACAGATAATTAAA ccaaa - 0 - 0.997 584906-584928 R caata TGTAATTGACTCATTAAGTTAGA tataa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back