ompX

Information for ompX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 848433-849320 - CDS ybiF EG12134 putative transmembrane subunit 849673-850188 + CDS ompX EG12135 outer membrane protein X 850237-851820 - CDS ybiP EG13321 putative enzyme

Reported regulatory sites for ompX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.127 849619-849641 ccatt AATTTTTGATATATTTAAAACTT aggac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.447 849598-849618 tcaca AATCGCGAAGAGTTTCCCATT aattt - 0 - 3.704 849553-849576 gcggt GTATGGAAACGTTCTGTTACATGA aatgg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back