oppB

Information for oppB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1299206-1300837 + CDS oppA EG10674 oligopeptide transport; periplasmic binding protein 1300923-1301843 + CDS oppB EG10675 oligopeptide transport permease protein 1301858-1302766 + CDS oppC EG10676 homolog of Salmonella oligopeptide transport permease protein

Reported regulatory sites for oppB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.713 1300906-1300922 gcaca GGCCAGAAGGTAGGGCA atgtt - 0 - 1.449 1300880-1300899 gtctg ATTTTTATCGCATTACAGAA ggcac - 0 - 1.060 1300843-1300859 tggca ATACGTGGGGCAGGAGT gtcct - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back