oraA

Information for oraA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2817403-2820033 - CDS alaS EG10034 alanyl-tRNA synthetase 2820162-2820662 - CDS oraA EG12080 regulator; OraA protein 2820731-2821792 - CDS recA EG10823 DNA strand exchange and renaturation; DNA-dependent ATPase; DNA- and ATP-dependent coprotease

Reported regulatory sites for oraA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.721 2820692-2820711 R acaca AGGGTCGCATCTGCGGCCCT tttgc - 0 - - 0.724 2820710-2820726 R atcgt CTTGTTTGATACACAAG ggtcg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back