osmB

Information for osmB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1340679-1341008 + CDS yciH EG11128 orf; hypothetical protein 1341134-1341352 - CDS osmB EG10679 osmotically inducible lipoprotein 1341621-1342370 - CDS b1284 EG13905 putative DEOR-type transcriptional regulator

Reported regulatory sites for osmB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.920 1341459-1341482 R ggaag TCATTATCACCTGCGTGATATAAC cctgc - 0 - 3.473 1341363-1341381 R acttc CGTGAATCATAAATTCAGG agaga - 0 - 2.545 1341490-1341506 R aaaat TATTATCAGCGATATAA cagga - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back