osmC

Information for osmC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1554089-1554367 - CDS b1481 EG14301 orf; hypothetical protein 1554649-1555080 + CDS osmC EG10680 osmotically inducible protein 1555136-1556062 - CDS b1483 EG13786 putative ATP-binding component of a transport system

Reported regulatory sites for osmC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.779 1554400-1554422 ttgtt AAGATTAGTCCTGGTTGATGATT tttat - 0 - 1.779 1554534-1554556 aattt AATTTAAGTGCAGAAGTAATATT ttcgc - 0 - 1.516 1554625-1554648 ttcct TTTTAAGCCCACAGGAGAGCAACA atgac - 0 - 1.257 1554370-1554393 cattc AGCATGGCAAATATTTGCCGCTTC gttgt - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back