osmE

Information for osmE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1819323-1819643 - CDS celA EG10140 PEP-dependent phosphotransferase enzyme IV for cellobiose; arbutin; and salicin 1819942-1820280 - CDS osmE EG10044 activator of ntrL gene 1820482-1821309 + CDS nadE EG10663 NAD synthetase; prefers NH3 over glutamine

Reported regulatory sites for osmE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.056 1820292-1820314 R caggc TTATCTAACACGCTGATAAACAA gagga - 0 - 3.906 1820309-1820327 R gccca ATGTATTCCAGGCTTATCT aacac - 0 - 2.379 1820383-1820401 R gctga ATGGTGGTTAAAACGTCAT acagg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back