otsB

Information for otsB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1978212-1979636 - CDS otsA EG11751 trehalose-6-phosphate synthase 1979611-1980411 - CDS otsB EG11752 trehalose-6-phosphate phophatase; biosynthetic 1980578-1980838 - CDS araH_2 EG10059 high-affinity L-arabinose transport system; membrane protein; fragment 2

Reported regulatory sites for otsB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.925 1980516-1980537 R ccata GCCAACCGCCATAACGGTTGGC tgttc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.945 1980479-1980502 R gttgc AAATGGCGACCCCCGTCACACTGT ctata - 0 - 1.373 1980457-1980478 R actgt CTATACTTACATGTCTGTAAAG cgcgt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back