pabC

Information for pabC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1151162-1152403 + CDS fabF EG12606 3-oxoacyl-[acyl-carrier-protein] synthase II 1152523-1153332 + CDS pabC EG11493 4-amino-4-deoxychorismate lyase 1153335-1154357 + CDS yceG EG11494 putative thymidylate kinase (EC 2.7.4.9)

Reported regulatory sites for pabC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.618 1152426-1152448 ttata AAAGGTCCGCTTGCGGGCCTTTT ttctt - 0 - 1.066 1152493-1152516 ctgcc ACACTAACAATTCTCTGATAAGGA gccgg - 0 - 0.833 1152450-1152467 ttttt TCTTAGCTTTTATTCCGA cttgt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back