panB

Information for panB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 147944-148795 - CDS panC EG11746 pantothenate synthetase 148807-149601 - CDS panB EG11675 3-methyl-2-oxobutanoate hydroxymethyltransferase 149715-150953 - CDS yadC EG11678 putative fimbrial-like protein

Reported regulatory sites for panB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.495 149695-149710 R ataac GTAGCAGCACTGTCAC cttct - 0 - 2.495 149676-149691 R acctt CTGGCAGTGCTGCTAC ggata - 0 - 0.863 149602-149625 R agcac AACATCAATTTATCAGGATACGTT atgaa - 0 - 0.431 149649-149669 R gataa ATCATTGCCCCCACCAATGTG actga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back