panD

Information for panD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 145081-146310 + CDS yadE EG11749 orf; hypothetical protein 146314-146694 - CDS panD EG11747 aspartate 1-decarboxylase 146968-147870 + CDS yadD EG11748 orf; hypothetical protein

Reported regulatory sites for panD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.837 146747-146769 R aatcg GGCAATACTGCGTGAGAATTTCC tcaaa - 0 - 1.369 146721-146743 R cctca AAGCAGGCATCGCCTGCTTCGTT aacga - 0 - 0.977 146814-146837 R tggca CGCTTCGGCGCGGTACGCAAACTG ctgac - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back