parC

Information for parC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3160760-3161497 - CDS plsC EG11377 1-acyl-sn-glycerol-3-phosphate acyltransferase 3161731-3163989 - CDS parC EG10686 DNA topoisomerase IV subunit A 3164127-3165734 - CDS b3020 EG13021 putative transport periplasmic protein

Reported regulatory sites for parC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.575 3164073-3164096 R ccggc GGCGCTATTCACGTTGATCTCCTG tgact - 0 - 1.575 3164039-3164062 R cgacg CGGCAGATAATGTAGTATCTCCGG caata - 0 - 1.059 3164011-3164034 R gcaat ATTGCCCCTTTGAAGGCTGGCGAA taagt - 0 - 0.513 3164098-3164119 R ccttt ATCGCCGTCGGAGCACGTCCGG cggcg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back