pbpG

Information for pbpG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2220205-2221920 + CDS dld EG10231 D-lactate dehydrogenase; FAD protein; NADH independent 2221958-2222899 - CDS pbpG EG12015 penicillin-binding protein 7 2223064-2223675 - CDS yohC EG12016 orf; hypothetical protein

Reported regulatory sites for pbpG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.488 2223013-2223033 R gcgta AATGTCAGCAATGCAGCATTT cctca - 0 - 0.998 2222995-2223011 R atttc CTCACGATTCTCCTTTG acgat - 0 - 0.692 2222949-2222971 R cgtta TGATGGCGTCGCTAGCCTCAGTA aatcc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back