pcnB

Information for pcnB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 157253-157732 - CDS folK EG11374 7;8-dihydro-6-hydroxymethylpterin- pyrophosphokinase 157729-159093 - CDS pcnB EG10690 poly(A) polymerase I 159186-160112 - CDS yadB EG11362 putative tRNA synthetase

Reported regulatory sites for pcnB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.757 159164-159182 R gagct ATGATTAGCCGCTATTTTT ttgtc - 0 - 3.757 159103-159121 R atttt TACCCGAGTCGCTAATTTT tgccg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.816 159126-159148 R tgatg TTTGACACTACCGAGGTGTACTA ttttt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back