pdhR

Information for pdhR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 120178-121551 - CDS aroP EG10084 aromatic amino acid transport protein 122092-122856 + CDS pdhR EG11088 transcriptional regulator for pyruvate dehydrogenase complex 123017-125680 + CDS aceE EG10024 pyruvate dehydrogenase (decarboxylase component)

Reported regulatory sites for pdhR: Genome coordinates Source Transcription factor Transcription factor annotation 121953-121969 DPInteract pdhR transcriptional regulator for pyruvate dehydrogenase complex 122044-122060 DPInteract pdhR transcriptional regulator for pyruvate dehydrogenase complex

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 10.866 122044-122060 catga AATTGGTAAGACCAATT gactt pdhR 17 - 4.563 121996-122016 aacct GTATGGACATAAGGTGAATAC tttgt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.483 121978-121994 tttca TGATTTCAATCAAAACC tgtat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back