pdxK

Information for pdxK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2533854-2534363 + CDS crr EG10165 PTS system; glucose-specific IIA component 2534406-2535257 - CDS pdxK EG12642 pyridoxal/pyridoxine/pyridoxamine kinase 2535362-2535736 + CDS yfeK EG12644 orf; hypothetical protein

Reported regulatory sites for pdxK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.555 2535333-2535352 R ttacc TTATCCTTGTTTTGTGATAG ccgat - 0 - 0.307 2535318-2535338 R ttttg TGATAGCCGATTTGACTGCCA gaatc - 0 - 0.291 2535272-2535294 R gttgg ATTACGATGAGGATCATCGGCAA ggaga - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back