pdxY

Information for pdxY, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1712401-1713006 + CDS gst EG12613 glutathionine S-transferase 1713050-1713913 - CDS pdxY EG13940 pyridoxal kinase 2 / pyridoxine kinase 1713972-1715246 - CDS tyrS EG11043 tyrosine tRNA synthetase

Reported regulatory sites for pdxY: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.450 1713935-1713954 R aaagg GGGAGTGAGAAATCACTCCC cctgg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back