pepB

Information for pepB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2652177-2652962 - CDS sseB EG11601 enhanced serine sensitivity 2653095-2654465 - CDS pepB EG12310 putative peptidase 2654556-2654756 - CDS yfhJ EG12311 orf; hypothetical protein

Reported regulatory sites for pepB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.947 2654535-2654550 R tttcc GCGTCATGCTTCACGC cgcag - 0 IRU12 (16) 1.128 2654521-2654541 R catgc TTCACGCCGCAGATGCGTTGG ctgcg - 0 IRU12 (21) 1.128 2654470-2654490 R agtta TCTATGCTCCTGGGGCTTCAC tcact - 0 IRU12 (21)

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back