pepD

Information for pepD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 253702-254202 + CDS prfH EG11496 probable peptide chain release factor 254259-255716 - CDS pepD EG10695 aminoacyl-histidine dipeptidase (peptidase D) 255977-256435 + CDS gpt EG10414 guanine-hypoxanthine phosphoribosyltransferase

Reported regulatory sites for pepD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.921 255787-255803 R tatct CGCAAGCCTGTCTTGTG ttgac - 0 - 2.921 255740-255756 R tgacc TGCAATACTGTTTTGCG ggtga - 0 - 1.913 255940-255958 R gcctg TTTATCTACGGCTTAAAAA gtgtt - 0 - 1.695 255759-255782 R gttga CAACATTTTCTGCTAACCCTGTGA cctgc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back