pepE

Information for pepE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4225310-4226941 + CDS yjbB EG11919 putative alpha helix protein 4227032-4227721 - CDS pepE EG11920 peptidase E; a dipeptidase where amino-terminal residue is aspartate 4227933-4228805 + CDS yjbC EG11921 orf; hypothetical protein

Reported regulatory sites for pepE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.293 4227778-4227801 R gtgcg ACATCGTGAGCCATGTCAGTAAGT ggtta - 0 - 0.664 4227915-4227931 R gcata AATTCTCCTGTAAAAAA cggaa - 0 - 0.259 4227895-4227918 R tgtaa AAAACGGAATATACCGTACCTTTG ggttg - 0 - 0.259 4227862-4227885 R gataa AAAATAGTCATGAGCGAACTATTT gttat - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back