pepN

Information for pepN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 988377-989579 - CDS pncB EG10742 nicotinate phosphoribosyltransferase 989845-992457 + CDS pepN EG10696 aminopeptidase N 992500-993267 - CDS ycbE EG12358 putative ATP-binding component of a transport system

Reported regulatory sites for pepN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.845 989717-989739 tacgc GGTGTATGTTATAAAAATGTAGC aataa - 0 - 1.323 989744-989767 caata AAGGCGTTTGTACCTGAAAAGATG aagat - 0 - 1.272 989783-989806 atagc GCGATTTACGCAACAGGAATAGAC tgaac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back