pepQ

Information for pepQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4026372-4028561 - CDS fadB EG10279 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase 4028751-4030082 + CDS pepQ EG10698 proline dipeptidase 4030079-4030696 + CDS yigZ EG11484 orf; hypothetical protein

Reported regulatory sites for pepQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.166 4028587-4028603 aggtg ATCTGGTCGTACCAGAT gagtc fadR 17 - 5.414 4028615-4028638 aagtg TGTATTTTGTGTTAAAAATATGCA aacaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.408 4028664-4028687 ccgat CTGATCACGCTCGGCAGAAATCAC gctct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back