pflA

Information for pflA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 948891-949481 + CDS ycaK EG12702 orf; hypothetical protein 949563-950303 - CDS pflA EG10028 pyruvate formate lyase activating enzyme 1 950495-952777 - CDS pflB EG10701 formate acetyltransferase 1

Reported regulatory sites for pflA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.919 950427-950444 R tccac GAAAGTGGGGCCTTTTTT agcgc - 0 - 1.858 950478-950497 R ctatg TAATTAGATTTGACTGAAAT cgtac - 0 - 0.430 950389-950404 R tgtca GCTATCTATACTTTAA ggtga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back