pfs

Information for pfs, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 177662-178462 - CDS yadT EG12334 orf; hypothetical protein 178455-179153 - CDS pfs EG11090 orf; hypothetical protein 179237-180754 + CDS dgt EG10225 deoxyguanosine triphosphate triphosphohydrolase

Reported regulatory sites for pfs: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.853 179195-179218 R tgaga AATACGCTTCCCCGTAAGCGCATG gtaaa - 0 - 1.728 179184-179201 R cgtaa GCGCATGGTAAACTATGC cttca - 0 - 1.580 179159-179179 R ccttc AAATCGGGCTTATCGCGAGTA aatct - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back