pgk

Information for pgk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3068185-3069264 - CDS fba EG10282 fructose-bisphosphate aldolase; class II 3069479-3070642 - CDS pgk EG10703 phosphoglycerate kinase 3070692-3071711 - CDS epd EG10368 D-erythrose 4-phosphate dehydrogenase

Reported regulatory sites for pgk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.391 3070644-3070665 R acttt TAGAATCAACGAGAGGATTCAC catgt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.253 3070676-3070692 R aggta AGACGCAAGCAGCGTCT gcaaa - 0 - 1.075 3070666-3070683 R gcaag CAGCGTCTGCAAAACTTT tagaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back