pgpB

Information for pgpB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1336594-1337184 - CDS ribA EG11331 GTP cyclohydrolase II 1337354-1338118 + CDS pgpB EG10705 non-essential phosphatidylglycerophosphate phosphatase; membrane bound 1338267-1338575 + CDS yciS EG13904 orf; hypothetical protein

Reported regulatory sites for pgpB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.308 1337229-1337252 ttgcc ATAACGAGAAGGGGTTCACCTAAT cacga - 0 - 3.233 1337283-1337299 tggca CAAATCTGTCAATTTTT cctgg - 0 - 1.386 1337325-1337344 ttatg ATTGTGGGACTTATCAAAAA ggaga - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back