pheP

Information for pheP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 597937-601080 + CDS ybdE EG12367 putative inner membrane component for iron transport 601182-602558 + CDS pheP EG10708 phenylalanine-specific transport system 602639-603886 - CDS ybdG EG12620 putative transport

Reported regulatory sites for pheP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.973 601137-601158 ctaaa TGTTAAAAGGTGCCCCTCAACA aaaaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back