phnA

Information for phnA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4322876-4323319 - CDS phnB EG10712 orf; hypothetical protein 4323977-4324312 - CDS phnA EG10711 orf; hypothetical protein 4324713-4326941 + CDS yjdA EG11210 putative vimentin

Reported regulatory sites for phnA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.896 4324367-4324385 R ttgtg TATAATTGCGGCCTTTTTC ggcaa - 0 - 2.017 4324386-4324407 R acccc CGACAAACTCAGGGATTTTGTG tataa - 0 - 1.365 4324605-4324628 R tactg CAAGAAATAATTTTATATTTAGTG tgttg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back