phnB

Information for phnB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4321955-4322743 - CDS phnC EG10713 ATP-binding component of phosphonate transport 4322876-4323319 - CDS phnB EG10712 orf; hypothetical protein 4323977-4324312 - CDS phnA EG10711 orf; hypothetical protein

Reported regulatory sites for phnB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.413 4323615-4323636 R cgccg CATCCGGCAACGGTGCCGACTG cctga - 0 REP325e (1) REP325f (8) 5.413 4323515-4323536 R cgccg CATCCGGCAATGGTGCCGACTG cctga - 0 REP325c (1) REP325d (8) 3.796 4323548-4323564 R accct CCGTAGGCCGGATAAGG cgttt - 0 REP325d (15) 3.796 4323448-4323464 R accct CCGTAGGCCGGATAAGG cgttt - 0 REP325b (15) 2.579 4323323-4323339 R gcttc TCTTAACTGAGGTCACC atcat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back