phnC

Information for phnC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4320914-4321930 - CDS phnD EG10714 periplasmic binding protein component of Pn transporter 4321955-4322743 - CDS phnC EG10713 ATP-binding component of phosphonate transport 4322876-4323319 - CDS phnB EG10712 orf; hypothetical protein

Reported regulatory sites for phnC: Genome coordinates Source Transcription factor Transcription factor annotation 4322799-4322820 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC)

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.676 4322799-4322814 R tgtta GTCACTTTTAATTAAC caaat phoB 16 - 0.518 4322825-4322842 R gtcat CGAATTCCCGTTAACTCT tcatc - 0 - 0.195 4322754-4322777 R tccgc CACGATGGAGCCACTTTTTTAGGG aggct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back