phnL

Information for phnL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4313660-4314796 - CDS phnM EG10722 phosphonate metabolism 4314793-4315473 - CDS phnL EG10721 ATP-binding component of phosphonate transport 4315584-4316342 - CDS phnK EG10720 ATP-binding component of phosphonate transport

Reported regulatory sites for phnL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.008 4315561-4315582 R ttgag CCGGTGCCGGATGCGGCGTAAA cgcct - 0 REP323b (17) 0.068 4315502-4315522 R ggtcg GATAAGACGCGTCAGCGTCGC atccg - 0 REP323a (21)

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back