phoB

Information for phoB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 414974-416176 - CDS sbcD EG11094 ATP-dependent dsDNA exonuclease 416366-417055 + CDS phoB EG10728 positive response regulator for pho regulon; sensor is PhoR (or CreC) 417113-418408 + CDS phoR EG10733 positive and negative sensor protein for pho regulon

Reported regulatory sites for phoB: Genome coordinates Source Transcription factor Transcription factor annotation 416285-416317 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC)

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.855 416294-416315 cataa ATCTGTCATAAATCTGACGCAT aatga phoB 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.715 416192-416213 tggcg AAAAAGCATGGGCGCGATTATA cccaa - 0 - 1.347 416217-416240 taccc AAACAGATGTGCCATTTGCTTTTT tctgc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back