phoE

Information for phoE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 257829-258230 + CDS crl EG11092 transcriptional regulator of cryptic csgA gene for curli surface fibers 258269-259324 - CDS phoE EG10729 outer membrane pore protein E (E;Ic;NmpAB) 259612-260715 + CDS proB EG10768 gamma-glutamate kinase

Reported regulatory sites for phoE: Genome coordinates Source Transcription factor Transcription factor annotation 259402-259434 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC) 259450-259482 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC)

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.486 259375-259396 R tcagg TTAAAAACTTTCCTGTTTTCAA cggga - 0 - 4.394 259494-259513 R gcgtt TTGTTGCGCGGGATCAGCAA gccta - 0 - 3.457 259405-259422 R taatc TGTAATATATCTTTAACA atctc phoB 18 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back