phoP

Information for phoP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1187539-1188999 - CDS phoQ EG10732 sensor protein PhoQ 1188999-1189670 - CDS phoP EG10731 transcriptional regulatory protein 1189839-1191209 - CDS purB EG11314 adenylosuccinate lyase

Reported regulatory sites for phoP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.646 1189722-1189740 R tttat TTAATGTTTACCCCCATAA ccaca - 0 - 0.540 1189798-1189813 R ggcga TGCTGTCCGGCCTGCT tatta - 0 REPt106 (11) 0.340 1189781-1189804 R gtccg GCCTGCTTATTAAGATTATCCGCT tttta - 0 REPt106 (2)

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back