phoR

Information for phoR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 416366-417055 + CDS phoB EG10728 positive response regulator for pho regulon; sensor is PhoR (or CreC) 417113-418408 + CDS phoR EG10733 positive and negative sensor protein for pho regulon 418815-420134 + CDS brnQ EG12168 branched chain amino acid transport system II carrier protein

Reported regulatory sites for phoR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.080 417061-417080 cgcct TGCTCATCGGACGCAGAGCA gggct - 0 - - 0.725 417087-417108 ggctt ATGATTTCTTAACTGGAGTATC ttacg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back