pitA

Information for pitA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3633838-3635040 - CDS yhiN EG12229 orf; hypothetical protein 3635272-3636771 + CDS pitA EG12230 low-affinity phosphate transport 3637015-3637350 - CDS yhiO EG12231 orf; hypothetical protein

Reported regulatory sites for pitA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.619 3635230-3635246 cactg ATAATGCGCCGCGTTCA tgtcc - 0 - 6.226 3635219-3635235 gccgc GAAAGTCACTGATAATG cgccg - 0 - 6.067 3635188-3635208 tcaaa AAAAGTCTATATTTCACTTTG cccgc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back