pitB

Information for pitB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3132146-3132838 + CDS yghT EG13004 orf; hypothetical protein 3132887-3134386 - CDS pitB EG12883 low-affinity phosphate transport 3134678-3136537 - CDS gsp EG12882 glutathionylspermidine synthetase/amidase

Reported regulatory sites for pitB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.966 3134424-3134440 R gccgt TAAAGTCACTGATAATG cgtcc - 0 - 3.425 3134479-3134499 R tgata CACAAGAAATAACACTCTTTT tatcg - 0 - 3.425 3134451-3134471 R tcgtt AAAAAATGATATTTCACTTTG cccat - 0 - 2.204 3134636-3134654 R cgtac TGATTATGAAGAATAATCA gtacg - 0 - 2.204 3134611-3134629 R tacgg GGATTAATCAAAATATTCA atatt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back