pldA

Information for pldA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4001841-4002326 - CDS yigI EG11467 orf; hypothetical protein 4002473-4003342 + CDS pldA EG10738 outer membrane phospholipase A 4003469-4005301 + CDS recQ EG10833 ATP-dependent DNA helicase

Reported regulatory sites for pldA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.874 4002329-4002349 cattg GTTAATGAAATGTTGATTTTA tgctt - 0 - 2.660 4002375-4002392 ctact TTAGGAAGGGATAACTAA cggct - 0 - 0.607 4002430-4002452 cagaa AAATATTCACCTTATCAATAATT cgtta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back